inköpen från dagens shopping i umeå med älsklingen

 
 
militärmönstrad tröja - gina tricot
 
spetströja med fransar - rut m.fl
genomskinlig tröja - hm
mönstrad bandeau - hm
             jeans blåa - rut m.fl                mönstrade leggings - gina tricot               jeans svarta - rut m.fl
 
 
 
 
 
smoky eyeshadows & light brown eyebrown liner - hm
 
 
 
 
 
s armband - gina tricot , svart med kors & blått med döskallar - ur och penn, svart med dödskallar - glitter
 
 
 
 
glittrigt - gina tricot
rosa glittrigt - hm
 
 
 
 
 
                    batiste dry shampoo - åhlens                shampoo & balsam apple fresh - ica maxi

28 februari - umeå

idag så var det tänkt att jag skulle sluta 11 från skolan eftersom det var omprovstillfälle på nk:n och eftersom jag klarade det behövde jag inte komma dit. så jag snackade med lärarna om jag kunde läsa hemma och tog ledigt idag. 
jag och älsklingen drog därför till umeå igår eftermiddag :D vad där i lagom tid till middagen och åt på great eastern. sen drog vi till några kompisar och spelade spel och såg på film. sov sedan där och imorse så drog vi ut på stan för en dag med shopping. hittade ganska mycket och är sjukt nöjd med allt. bilder kommer sen. 
vid 3 tiden kände vi att vi var nöjda och började rulla hemmåt. nu håller vi på att göra middag och sen blir det att stöka och böka och kanske spela en och en annan lol match.
 
 
tack för den här gången umeå

lunchar med han som förstår mig bäst, betyder mest


26 februari

åh jag känner mig stressad hela tiden. 
jobb, plugg, stökigt i lägenheten, prov, bloggandet, träningen osv. vad jag än gör så känns det som att jag har tusen saker kvar att göra. ikväll blir det att försöka träna och sen pluggapluggaplugga inför provet imorgon.
 

25 februari - finaste

 
 
 
 
fick ett par skitsnygga skor med guldfärgade nitar på av älsklingen idag ♥ tack älskling :):):):):):) ♥
 
minns ni då jag tipsade om members.com? dessa godingar kostade 500:- innan men tack vare members så klickade älsklingen hem dom för endast 80 kr! 
vill du ha en invite? kommentera då din mailadress!

23 februari - sweet saturday

godkväll alla fina människor! 
åh min lördag har varit jätte fin. vaknade vid halv sju och vid åtta så var jag i bocksliden redo för en dags jobb.
var jätte mycket folk där eftersom det var lilla världskuppen så åtta timmar flög förbi och vid halv fem så kom gubben och hämtade mig. for hem till oss en sväng oss drog med oss niki, rasmus och andreas till golden bar. tog lövbit, gött!
drog förbi ICA och köpte lite godis. dom har typ jätte billigt lösgodis, 39:- kg! skynda fynda!
sen så har vi suttit i typ tre timmar och spelat wii u! var fan skit kul!  vi ska typ klicka hem ett imorgon hihi :)
 
menmen, nu ska jag sova eftersom jag ska jobba imorgon också. själv för första gången, ändå läskigt! 
hihi godnatt ♥
 


 

22 februari- dagens


tänkte tipsa om en grej

ladda hem denna app, den heter 4 pics one word och är skitkul! 
man får då tänka hur mycket som helst på vissa, tips!
 
 
 


hade paket då jag kom hem!

betällde massor med saker för typ två veckor sen, och nu då jag kom hem så hade vi fått paketet :D lycklig, nostalgisk osv!!! :D
i det var det 5 skal till mig, ett till älsklingen, en dubbel ring med mustash, ett halsband med mustash och en navelpiercing! lycklig.
 

21 februari - outfit


onsdags mys med älskling

nu ska vi mysa ner oss i sängen och se lite nya avsnitt av family guy och äta B & J! ♥
 

då det är över -20 grader ute äre kallt


gjort om i bloggen

tyckte det vart för mycket mönster med kamuflage och headern och allt. har då gjort om designen nu och gjort en ny tillfällig header. ska göra en annan senare då jag har tid :)
ni som inte ser, tryck F5. kommentera gärna vad ni tycker! :)

klagar victoria i farten

tjabba tjena hallå. 
sitter på skolan igen då. kollar facebook typ. eftersom man har gjort klart alla truck uppgifter så har dom inte mer saker man kan göra så jag sitter här och ruttnar typ. sen har jag rast från 10 till halv 1. så himla ovärt! 
skulle ha ''råkat försovit mig'' imorse. så känns det just nu!
suck suck suck less less less osv.
 

20 februari - dagens outfit


19 februari

hej allihopa! 
fält på förmiddag, övningskörning på eftermiddagen. for längst en liten väg som skulle trampas inför rally i helgen så vi skulle köra där, gick typ 20 km / timmen. sen drog vi på shell och drog en fika med chrille och oscar.
efter jag slutade så for jag hem och mötte upp pappa. han hade lagat min damsugare! så himla snällt♥ den har typ varit trasig i en månad så jag har inte kunnat dammsuga på länge, så ni kan ju fatta hur det såg ut här inne! men nu har jag då dammsugat hela lägenheten så nu känns allting mycket bättre. syrran kom förbi och åt middag med mig. 
vid 6 for hon hem och jag satt mig vid skype och pratade med älsklingen min ♥
 
nu ska jag då återgå till mitt kvällsgöra : plugga naturkunskap inför provet imorgon.
 

puss, godnatt

 
gick sådär med att plugga ikväll om jag ska vara ärlig. men får plugga riktigt hårt imorgon! 
nu ligger jag då i sängen och kikar på family guy och har lite smått ont i huvudet. så nu ska jag ta en ipren och sen ligga här och somna till min favvo serie ♥ 
 

kvällsfika


this is how to be a heartbreaker


my night isnt a party night

jaha victoria vad händer ikväll? jo ikväll kommer jag att ha fullt upp. det är nämligen tvätt tid idag så för det första så kommer jag springa upp och ner till tvättstugan hela kvällen. för det andra så ska jag försöka att plugga inför ett prov mellan besöken till tvättstugan. på onsdag så har jag prov på eftermiddagen i ämnet naturkunskap. och eftersom jag inte har prov så ofta för att vi bara har två ämnen så tänkte jag plugga lite extra till det här.
 

if you lovin' like i lovin

trevlig gårdag hade jag med älsklingen. spelade lite, såg tv, var ute och åt med mamma, syrran, ronny, mormor och morfar och bara myste! synd att han gatt fara igen imorse. hoppas han slutar på onsdag, annar syns vi på torsdag.
annars då? plugget idag, lååång dag. slutar inte förens vid halv 4. suck! hoppas dagen går fort!
 
 
detta var min goda mat jag åt igår, ååååh nu blev ja hungrig..

18 februari - dagens outfit


17 februari - jag har världens underbaraste älskling

vaknade på bästa sätt. jag har världens underbaraste pojkvän! älskar dig så♥
 
 
sent alla hjärtansdags firande kommer stå på menyn idag!

race i björksele

drog som sagt till björksele idag med mamma, syrran och ronny.
det var nämligen hundkörar träff där idag så det var ganska mycket folk där som skulle ut med hundarna deras. vi skulle fara till vormsele så det blev en 14 km sträcka. men det var skit kul och gick jätte bra :)
 
ronny tog skidorna med två hundar
 
 
jag tog spann med fyra hundar ( tyck om er älsklingar )
 
 
och lillan fick va hemma och gosa med matte!
 
 
syrran var fotograf till alla bilder förutom dom på lillan som jag tog.

16 januari

godmorgon gubbar och gummor! 
vaknade vid 11 imorse och var sjukt utvilad, har sovit 10 timmar inatt, skööönt!
har käkat lite frukost och hunnit spela litegrann. hihihihihihihi nörd. tycker det är skitkul, drömde till och med att jag var med i spelet. omg det börjar gå lite överstyr....hihi.
ska väl börja fixa och dona för om en timme så bär det av till björksele för att köra hundspann :D
 
min frukost, kvarg med jordgubbssylt.
 

baby you make my palm sweaty, knees weak, arms spaghetti


you make me feel good

haft en bra kväll med fint sällskap. raggat lite, spelat mycket. bara haft det super mysigt! precis vad jag behövde :)
nu ska jag nog ta och sova snart, men ska kolla lite family guy innan ;) godnatt, PUSS.
 

hade tråkigt så lockade håret och testade ny sminkning

 

god middag


eftermiddags träning

for ut och gick / sprang efter skolan idag. gick i typ en halvtimma, och sprang i typ en kvart.
men idag så sprang jag samma längd som jag sprang i tisdags plus 50% till! nästan dubbelt så mycket! plus att jag sprang det på samma tid. (alltså det jag sprang i tisdags och det jag sprang idag tog lika lång tid) tycker det är skitbra då man tänker att jag förut fick blodsmak i munnen efter bara en minuts springning.. är då nöjd iallafall :D nästa gång kommer jag nog springa dubbelt så långt som de jag sprang i tisdags!
och efter min lilla spring tur så gjorde jag mag + benövningar så nu är jag helt slut...
 

15 februari - lunch med mamma


rihanna - stay ft. mikky ekko

 
                

onödigt som ***

 
jag var ute på promenad tidigare med rulle. när jag kom hem så upptäckte jag att jag inte längre hade mitt bankkort i fickan. letade i hela lägenheten utifall att jag hade glömt det hemma men icket. så jag skyndade mig på nordea och spärrade kortet. 20 minuter senare så ringer mamma och säger att någon hade hittat mitt kort och lämnat in det på nordea. men jag hade ju redan hunnit spärra det så jag hade ju ingen nytta av det. så nu är jag kort lös = penga lös. jippi.
önskar att jag hade tagigt det lite mer chill med att spärra kortet. men jag ville ju inte direkt att någon annan skulle hitta det och använda det. men aja, gjort är gjort!
 
                      

tur att jag har en söt mamma ♥

 
hihi jag blev också uppvaktad idag :D

hundvakt till gullgubben

kom nyss hem från skolan. träffande antonia ett tvärt eftersom jag ska vara hundvakt till hennes hund idag! 
nu ska jag och rulle ut på en promenad! :)
 

valentines day

idag så är det den 14 februari. och som dom flesta vet så är det alla hjärtans dag idag, den romantiska dagen på året!
hur ska då jag spendera min alla hjärtans dag?
ja, eftersom min kära pojkvän är i arvidsjaur på jobbet ända tills på söndag så jag kommer då inte umgås med han. kanske ett telefonsamtal och massa gulliga sms, får bara hoppas att han kommer ihåg vad det är för dag idag haha ;) tur som det är så fyller iallafall min morfar år på alla hjärtans dag så dagen min kommer ändå att bestå av go fika och få ungås med nära och kära!
 
hur ska ni spendera eran alla hjärtans dag?

14 februari - dagens outfit

 
en myspysigjagorkarintebrymigomhurjagserutidagdärförharjagmunkjackaochuppsatthår outfit.
 

godnatt sötnosar


myskväll med min fina

kom hem från födelsedags firandet vid kl 6, Jennelie kom till mig bara en lite stund efteråt. vi har suttit och spelat lol hela kvällen, naaiiiz! nu har vi då gjort oss klar för sängen och ligger och kollar på lite alice i underlandet. haha det var skit längesen jag såg den! den är ändå bra, tycker då jag som älskar disney filmer mer än allt annat hihi.


paket från yves rocher

jag har haft en parfym i ca 3-4 år nu som luktar vanilj och luktar verkligen jätte gott!
men förra veckan så tog min trogna tjänare slut. min älskling blev ungefär lika ledsen som jag då han också tycker att den luktar skit gott så vi bestämde oss för att kika lite på nätet efter en ny. klickade in på yves rochers hemsida och hittade en flaska för endast 49:- ! billigt och bra! så sebbe beställde en med vaniljdoft till mig ( den jag hade sen tidigare ) och sen hittade jag en annan som luktar cocos! och eftersom jag har en liten förälskelse i cocos så gatt jag bara köpa en sån! paketet kom idag och jag har provluktat på begge två och är super nöjd! :D
 

fick också en present faktiskt!

då mormor och morfar kom till mamma för att fira syrran så hade dom faktiskt med sig en liten present till mig också! fick en skit snygg '' burk '' som jag ska ha cupcakes och andra bakverk i! skit söt hihih :*
 
 
gjorde kanske sig inte bäst på bild eftersom materialet är som en spegel haha.

firandet av min kära syster

och sen födelsedagsbarnet i egen hög person!
alltid lika charmig.

roligt med skola


grattis syrran 16 år! puss å kram


13 februari

tjaa!
onsdag idag, dryg skoldag som inkluderar en 3 timmars hål. suck! blir att sitta och spela kort nu tills klockan har slagigt halv 3 :)
 
 
fuck it

gör det som känns rätt


you can find beauty in an apple

hittade världens sötaste äpplen då vi var och handlande på ica södermalm! tror det är inför alla ♥ dag,
visst var dom fina? :D 
 

curly hair today

 
                          
           
        

hurtboll

slutade kl tre från skolan. och då bestämde jag mig för att jag skulla gå ut och gå! :) 
hurtigare än få så sprang jag även också! vet inte riktigt hur långt det blev, men ca 2 km kanske. är dock ändå sjukt nöjd över att kunna springa 2 km utan att stanna, då jag hittills kanske har sprungit 3 gånger per år och därefter varit stendöd. haha så sjukt lite jag har sprungit i mitt liv. men nu ska jag börja springa mycket mer, lite kondis har väl ingen dött av? ;) 
 
                         
                        

god middagen

                                           smootie ♦  äpplen med naturell yogurt ♦ ägg
är egentligen allergisk mot allt som har med frukt att göra men bestämde mig att fan, nu har jag inte ätit en frukt på över 2 år så det är väl ändå dags snart? och då jag kände att det började klia i munnen sköljde jag bara med vatten. lätt värt det!
 

12 februari - dagens outfit

 
munkjacka - ellos Δ jeans väst - sebbes mammas gamla Δ halsband - åhlens Δ klocka - guldfynd Δ jeans - sthlm

11 februari

hej alla roliga människor.
feber och huvudvärk står på dagens schema. jag smittade gubben som sedan smittade mig tillbaka. what goes around comes around i guess..
vad som mer står på dagens schema är tandläkaren kl 1, undrar vad dom har att säga?
 
                                              

bilder från kvällen min

hundspanns körning på G
sebbes familjs nyaste tillskott! ♥ in love
 
 
 
 

tillsammans för alltid

och bilen bara krånglar! sebbe och morfar har varit ute sen klockan tio och försökt få upp dörrarna till bilen. batteriet har varit så jävla dött så bilen inte ens har orkat få upp dom. suck!
aja men nu är då dörrarna uppe. då nu gäller det att bara ha i motorvärmaren på ett tag innan vi drar vidare till björksele
 

go champis


10 februari

godmorgon snyggon!
vaknade tidigt även idag, det är då likest, så man inte sover bort hela dagen! :) 
idag hade vi tänkt oss fara till björksele en sväng och se om det händer någonting roligt där. ska ta med systemen och ta lite kort på deras nya valp också! tror nog att det kommer att blir så att jag kommer försöka att kidnappa hem den...hihi. 
men vi ska då inte fara än, ska spela lite lol först! ååå vad nörd jag har blivit! men det är faktiskt skit kul!
 
PUSS Δ

ny skyddsplast, riktigt jävla snyggt!

 
och sen jag med min otroliga förmåga att alltid få luftbubblor på varenda skyddsplast.

älskar dig min fina

 

9 februari

godmorgon alla! eller nu kanske det är god eftermiddag...hiiihi ooopps.
vi vaknade ändå tidigt, tror klockan var nio. men då kollade vi på lite film, batman begins för att vara exakt. skit bra!
jag tycker faktiskt alla batman filmer är bra :) tips till er som inte har sett dom och vill ha några bra filmer att se!
sen dess har vi spelat lite lol, och det kommer vi fortsätta med i eftermiddag! PUSSAR
 
  

härligt med renbäddat efter dusch


taggar sönder

just bokat biljetter till stockholm i maj med mina brudar jennelie och frida!
vi drar dit lördagen den 25 maj och far tillbaka den 27. och medans vi är där så ska vi b.la se p!nk i globen!! :D kommer bli skit skoj!  taggataggataggataggataggataggatagga!!
 
 

8 februari

hej alla! 
dålig update idag men jag har gjort en massa. först så stannade jag kvar efter skolan för att köra lite lastbil.
gick sedam hem för att hinna spela lite LOL och starta en maskin med tvätt innan vi for iväg till mamma för att äta lite middag. vart räksoppa! något så jätte gott! efter det drog jag till frida ett tag där jennelie och hon var. vi satt och fipplade, beställde massor och sedan gick jag hem. kvällen kommer bestå av spel och tvättstuge- häng! (y)
 
      
 
 en bild på jag och jossan från idag då vi åt en klubba som gjorde att vi kunde misstas för smurfar

ricinolja - för håret

Ricinolja ska

  • Motverka torrt hår
  • Få håret att växa snabbare och göra det tjockare
  • Ge näring och glans
  • Motverka håravfall

 Bakgrund

Från början är ricinoljan känd och använd som laxeringsmedel man ska ta vid tillfällig svår förstoppning, inför en röntgenundersökning eller ett kirurgiskt ingrepp. Vi unga tjejer känner igen den mest som oljan som får håret att växa!

 

Hur ricinoljan fungerar

När du masserar hårbottnen ökar blodcirkulationen i hårsäckarna vilket gör att håret växer snabbare. Det är viktigt att oljan når rötterna, ricinolja innehåller omega-9 fettsyror som ger näring och förhindrar att hårbotten torkar ut. 

Applicera oljan i hårbotten och massera in den och låt verka en halvtimme. Detta ska man göra 3-4 gånger i veckan. Du kan även ha oljan i längderna som en återfuktande inpackning.

 
 
 
köpte denna på apoteket alldeles nyss. finns även att beställa från bodystore.

shoes, a girls best friend

 
på members.com så har dom massor med erbjudanden. bland annat så har nelly.com just nu rea på alla sina skor. skor som förut kostade 500:-, kostar nu 129! Vill du ha en invite? kommentera då din e-mail adress! då kommer du även att få 50:- extra att handla för! skynda på, rean gäller bara i 1 dag och 20 timmar till!

7 februari

har laddat hem en app som gjorde att man kunde ''byta utseende'' på apparna som man har! :) vart faktiskt väldigt fint!

lägger upp bilder på tjejer med text över ansiktet

                                   
                           
                           
                     
                
                
 

6 februari

har just spenderat hela förmiddagen i en lastbil. körde dock inget utan åkte med en 3:a. 
åt nyss lite lunch och väntar på att tiden ska gå. idag slutar jag halv 4 och börjar jobba halv 5. och jobbar till halv 10. 
men vi kanske hörs då! :) annars får ni ha en bra onsdag♥
 
                                 
 

bara älskvärd

hej alla!
varit dålig på att blogga men har haft fullt upp idag. övningskörde lite scania i eftermiddags, drog senare hem till pappa och åt middag. han skjutsade sen mig till lägenheten så jag fick packa och byta om. efter det så drog jag vidare till otilia och grattade henne eftersom hon fyllde 18 år igår!! stort grattis till henne!:)
bestämde mig sedan för att gå tillbaka till hedlunda från stan. tog ungefär en timma och var väl en ca 8 km promenad, och den var riktigt skön! var bara minus 6 grader ute så det var riktigt härligt!
men nu ska jag då iallafall duscha och sedan sova jävligt gott! hihi :) godnatt på er!


5 februari - godmorgon

                        

im still waiting for you

godkväll alla! 
kom ganska nyss hem från jobbet, har varit en ganska jobbar-dag, hade bara inte lusten alls!
avslutade just ett härligt telefonsamtal från min allra finaste och nu saknar jag honom ännu mer..♥♥♥
aja, godnatt peeeeepz!
 
                             

kika in denna video!

ni kommer inte bli besvikna! så grymt coola!
 
 

nyaste inköpet - topp lack

har länge velat ha ett bra topplack, men har aldrig hittat något bra. det har bara gjort så att det ursprungliga nagellacket tar längre tid att torka och det brukar bli klibbigare. så jag började använda ett nagellack som egentligen är till för att stärka naglarna, men det blir ju inte samma sak.
så när jag har läst några bloggar så har jag sett några som tipsar om detta, Seche Vite. 
har hunnit använda det en gång och det var super bra! torkade väldigt snabbt också. rekomenderar det verkligen. finns att köpa på åhlens för en billig peng :)
 

gymmet nu


4 februari

                       
 
haha tänkte börja min morgon med att visa er denna bilden då jag dog lite då jag såg den. haha godmorgon!
uppe med tuppen idag. eller iallafall med solen, vet inte riktigt närtuppen brukar gal. aja, väckaren var ställt på 08:30 för att ta en morgons tur på gymmet med jennan! skönt som fan kommer det att bli! taggad victoria!
 

ledig imorgon, godnatt!


äntligen träning

var skönt att få träna ikväll! är dock fortfarande lite sjuk och hostan hemsöker så blev ett rätt så lugnt pass. men ändå!
kom ganska nyss hem. så nu hade jag tänkt att plocka undan lite, duscha och sedan spela lite med min vän jennelie! :)
och tänker försöka inte att gå och lägga mig alldeles för sent ikväll, vore dumt att vända dygnet bara för att jag är ledig imorgon.
 
                      
                      
                      
                                          
 
 

kik & snapchat me

 

dagens citat

                                

nytt isticky på telefonen


the new nail polish


3 februari

godmorgon alla! ♥
har egentligen varit vaken i två timmar men har kollat lite serier och fipplat med naglarna.
hade tänkt gå ut och gå idag men då visade de sig att det var -17 ute. och eftersom jag förfrös mina kinder + näsa då vi var ute och körde skoter i fredags så ville jag inte vara ute i kylan.
så skrev till min vän jennan och ikväll drar vi till gymmet för ett kondis pass. men ska inte ta i för hårt. 
har fortfarande hosta så vill inte förvärra saken. vill bli frisk nån gång!
 
 
me right nowwwwww

josefine och sebbes katt - torsten


2 februari - bra gårkväll i nyhult med skoterkörning osv


So long

drar till josefine och deras nya hus för att köra skoter och ha det mysigt! så inga fler inlägg idag eftersom det inte finns något internet där ute! puss


1 februari - and friday